circad | circRNAs associated with diseases

HRCR/mm9-circ-012559/mmu_circ_0000254
Gene	PWWP2A	Organism	Mouse
Genome Locus	chr11:43518035-43518979:+	Build	n/a
Disease	Hypertrophic cardiomyopathy	ICD-10	Dilated cardiomyopathy (I42)
DBLink	Link to database	PMID	26802132
Experimental Method
Sample Type	Tissues	Comparison	Wild type vs Cardiac hypertrophy and heart failure induced mice
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TCCGGTTTGTCCTTATATTC Reverse ACTGGAGAAAATTCGGAGT	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Wang, K, Long, B, Liu, F, Wang, JX, Liu, CY, Zhao, B, Zhou, LY, Sun, T, Wang, M, Yu, T, Gong, Y, Liu, J, Dong, YH, Li, N, Li, PF (2016). A circular RNA protects the heart from pathological hypertrophy and heart failure by targeting miR-223. Eur. Heart J., 37, 33:2602-11.